Enantioseparation of isoxanthohumol in beer by hydroxypropyl-gamma-cyclodextrin-modified micellar electrokinetic chromatography

Chiral resolution of isoxanthohumol (IX) in beer samples was performed by hydroxypropyl-gamma-cyclodextrin-modified micellar electrokinetic chromatography. The optimum running conditions were found to be 20 mM phosphate buffer (pH 7.0) containing 45 mM hydroxypropyl-gamma-cyclodextrin and 100 mM sodium dodecyl sulfate with an effective voltage of +20 kV at 20 degrees C using direct detection at 210, 295, and 370 nm. IX was detected in 12 beer samples and the total levels of (+)- and (-)-IX ranged from 0.15 to 1.4 mg/L. But the amount of xanthohumol (XN) was below the detection limit (0.017 mg/L). Each level of (-)-IX was almost the same as that of (+)-IX, suggesting that IX was a racemic mixture in these beer samples. The racemization of IX in beer could be attributed to the production of a racemic mixture from XN during boiling and to the fact that IX enantiomers were easily interconverted.     

Monetary costs of dietary energy reported by young Japanese women: association with food and nutrient intake and body mass index

OBJECTIVE: Little is known about the relationship of monetary diet costs to dietary intake and obesity, particularly in non-Western populations. This study examined monetary cost of dietary energy in relation to diet quality and body mass index (BMI) among young Japanese women. DESIGN: Dietary intake was assessed by a validated, self-administered, diet history questionnaire. Diet costs were estimated using retail food prices. Monetary cost of dietary energy (Japanese yen 1000 kcal-1) was then calculated. BMI was computed from self-reported body weight and height. SUBJECTS: A total of 3931 female Japanese dietetic students aged 18-20 years. RESULTS: Monetary cost of dietary energy was positively associated with intakes of fruits, vegetables, fish and shellfish, and pulses; however, higher monetary cost of dietary energy was also associated with higher consumption of fat and oil, meat and energy-containing beverages, and lower consumption of cereals (rice, bread and noodles) (all P for trend <0.01). At the nutrient level, monetary cost of dietary energy was positively associated with intakes of dietary fibre and key vitamins and minerals, but also associated positively with intakes of fat, saturated fatty acids, cholesterol and sodium, and negatively with carbohydrate intake (all P for trend <0.0001). After adjustment for possible confounders, monetary cost of dietary energy was quite weakly but significantly negatively associated with BMI (P for trend = 0.0197). CONCLUSIONS: Increasing monetary cost of dietary energy was associated with both favourable and unfavourable dietary intake patterns and a quite small decrease in BMI in young Japanese women.     

Histone H4 Modification During Mouse Spermatogenesis

The core histone is composed of four proteins (H2A, H2B, H3 and H4). Investigation of the modification patterns of histones is critical to understanding their roles in biological processes. Although histone modification is observed in multiple cells and tissues, little is known about its function in spermatogenesis. We focused on the modification patterns of histone H4 during murine spermatogenesis. We demonstrated that the individual N-terminal sites of H4 show different modification patterns during the differentiation of male germ cells. The methylation pattern varied depending on the residues that were mono-, di-, or tri-methylated. All the H4 modifications were high during the meiotic prophase, suggesting that histone H4 modification plays an important role during this stage of spermatogenesis. Elongating spermatids showed increased acetylation of histone H4, which may be associated with a histone-to-protamine substitution. Our results provide further insight into the specific relationship between histone H4 modification and gene expression during spermatogenesis, which could help to elucidate the epigenetic disorders underlying male infertility.     

An economic value for ecosystem-based disaster risk reduction using paddy fields in the kasumitei open levee system

Paddy and Water Environment - In this article, we examined the value of the traditional Japanese flood control measure that uses a discontinuous levee (kasumitei). By avoiding the use of...     

Yield estimation of 1-year-old asparagus grown using rootstock-planting forcing culture

Rootstock-planting forcing culture was developed in asparagus to harvest spears even during the seasons when the plants become dormant, but the demand for them high. In this study, cumulative hours during which the air temperature remained lower than 5°C, i.e. chilling hours (CHs), were calculated to determine dormancy breakage for asparagus cultures. We also measured CIELab colour values for cut stems immediately before rootstock digging, and determined whether they could be substituted and/or compensated for CHs while evaluating asparagus plant productivity in different low-temperature backgrounds, and obtained regression equations for yield estimation. Asparagus seedlings were cultivated in seven different regions across Japan and brought to the study site for harvesting. Our regression equation based on CHs and rootstock weight for yield estimation had relatively high fitness (adjusted R² = 0.5795). The colour values of cut stalks at rootstock digging can also be used to evaluate their productivity. These values can be useful in regions where CHs cannot be determined, although their effectiveness was slightly lower than that of CHs of areas adjacent to the study sites.     

The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.     

Quantum criticality without tuning in the mixed valence compound beta-YbAlB4

Fermi liquid theory, the standard theory of metals, has been challenged by a number of observations of anomalous metallic behavior found in the vicinity of a quantum phase transition. The breakdown of the Fermi liquid is accomplished by fine-tuning the material to a quantum critical point by using a control parameter such as the magnetic field, pressure, or chemical composition. Our high-precision magnetization measurements of the ultrapure f-electron-based superconductor β-YbAlB(4) demonstrate a scaling of its free energy that is indicative of zero-field quantum criticality without tuning in a metal. The breakdown of Fermi liquid behavior takes place in a mixed-valence state, which is in sharp contrast with other known examples of quantum critical f-electron systems that are magnetic Kondo lattice systems with integral valence.     

Effects of growth and dietary crude protein level until first insemination on milk production during first lactation in Holstein heifers

To decrease the age at first calving in Holsteins, the effects of average daily body weight gain (ADG) and crude protein (CP) level until first insemination on growth performance and milk production were examined. The MM group had a target ADG of 0.75 kg and received a diet with a CP level of 14%. The HM and HH groups had a target ADG of 1 kg; both these groups received a diet with CP levels 14% and 16%, respectively. The ADG in the HM and HH groups was 1.1 kg, whereas in the MM group it was 0.97 kg (P < 0.01). The HM and HH groups showed no differences in withers height at body weight 350 kg. The ages at first calving in MM, HM and HH groups were 23.1, 21.0 and 21.8 months, respectively. The HM and HH groups had lower milk yield at day 305 than the MM group (P < 0.01). These results suggest that growth performance until first insemination should be maintained at an ADG of 0.97 kg or less with a CP level of approximately 14%, to shorten time until first insemination and prevent the decrease of milk yield.